| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.208841 |
| Chromosome: | chromosome 12 |
| Location: | 2106244 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509200 | (1 of 1) PF00722//PF03935 - Glycosyl hydrolases family 16 (Glyco_hydro_16) // Beta-glucan synthesis-associated protein (SKN1) (SKN1); weakly Similar to Beta-Glucan Synthesis-Associated | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGTTGCGGTCGCACGTGTCGTAGCTGA |
| Internal bar code: | AGGCGCCGTACAATAAGAGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 794 |
| LEAP-Seq percent confirming: | 99.5759 |
| LEAP-Seq n confirming: | 5165 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTTCGGACCAGGAGAAC |
| Suggested primer 2: | AAAGTCCAACCTTGTGACGG |