| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.208855 |
| Chromosome: | chromosome 9 |
| Location: | 3641940 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390356 | (1 of 1) PTHR22849//PTHR22849:SF0 - WDSAM1 PROTEIN // WD REPEAT, SAM AND U-BOX DOMAIN-CONTAINING PROTEIN 1 | intron | |
| Cre09.g390393 | (1 of 5) PF01713 - Smr domain (Smr) | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGCTAGGACTTGCATCACCGGCACTTT |
| Internal bar code: | ATAGGTCAACGGTTATTCTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 239 |
| LEAP-Seq percent confirming: | 99.7888 |
| LEAP-Seq n confirming: | 8506 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGCTGTCTTCAAGAGGT |
| Suggested primer 2: | CCTCTTTGAAGTCGTAGCCG |