Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.208869 |
Chromosome: | chromosome 11 |
Location: | 2392152 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g474800 | OTA1 | Ornithine transaminase; (1 of 1) 2.6.1.13 - Ornithine aminotransferase / Ornithine--oxo-acid transaminase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGGCTGATGTAACTTGACTTAAGGATG |
Internal bar code: | AGAGTACGTTACTCCTCGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 59 |
LEAP-Seq percent confirming: | 40.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCACCCAGCACTTAGGAG |
Suggested primer 2: | AGAATACATGCGACAAGGGG |