| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209035 |
| Chromosome: | chromosome 1 |
| Location: | 6604548 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047265 | PHC52 | (1 of 1) IPR000772//IPR003882//IPR024616 - Ricin B, lectin domain // Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 52 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCATCTCAAGCCCCTCACCTCCGCCGGAT |
| Internal bar code: | TGGCCTCAGAAGCCTGACGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 862 |
| LEAP-Seq percent confirming: | 97.193 |
| LEAP-Seq n confirming: | 831 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCCCGTATCCTCCTC |
| Suggested primer 2: | CGAATAGGCAACCAACCAGT |