| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209110 |
| Chromosome: | chromosome 3 |
| Location: | 5367392 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184400 | (1 of 3) 3.6.1.22//3.6.1.55 - NAD(+) diphosphatase / NADP pyrophosphatase // 8-oxo-dGTP diphosphatase / 8-oxo-dGTPase; Putative NAD+ diphosphatase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAGGGCGTATCTTGGCCTTCTCTAATCA |
| Internal bar code: | GGGCCTCCCAGCTGCACCCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 997 |
| LEAP-Seq percent confirming: | 99.568 |
| LEAP-Seq n confirming: | 461 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCTGCCGTACTCTCGTT |
| Suggested primer 2: | GTCGCGGTTGTATCCCTTTA |