| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209125 |
| Chromosome: | chromosome 9 |
| Location: | 1866987 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395600 | OBGC,OBGC1 | Factor possibly involved in assembly of the ribosomal 50S subunit; (1 of 1) PTHR11702:SF3 - GTP-BINDING PROTEIN 10 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGAACGCAGCCGCGGCTGCGGGTTGAAG |
| Internal bar code: | CGGAGATTGGTCCAACGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 137 |
| LEAP-Seq percent confirming: | 84.0095 |
| LEAP-Seq n confirming: | 352 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGGGTAGGGTTACACGC |
| Suggested primer 2: | ACGCACATGGAATACGAACA |