| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.209130 |
| Chromosome: | chromosome 1 |
| Location: | 2715383 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016100 | (1 of 7) IPR011048 - Cytochrome cd1-nitrite reductase-like, haem d1 domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGCCCCCGCAATCGGCAAGTGTACCGG |
| Internal bar code: | TGATTAAGCCACGGAAGTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 491 |
| LEAP-Seq percent confirming: | 20.5206 |
| LEAP-Seq n confirming: | 741 |
| LEAP-Seq n nonconfirming: | 2870 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGTCAACGCAAGGCTGT |
| Suggested primer 2: | TTGCAGTGTGCAATGCTGTA |