Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.209133 |
Chromosome: | chromosome 13 |
Location: | 3106155 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g584850 | (1 of 15) 2.5.1.18 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCCCGCCAGGACGCTGTTCGCCAACT |
Internal bar code: | TCGGGCTTGTAACTCCTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 937 |
LEAP-Seq percent confirming: | 99.3501 |
LEAP-Seq n confirming: | 7185 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCACAAGCCATTGAGAGA |
Suggested primer 2: | TCACGCACACTCAGACATCA |