Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.209438 |
Chromosome: | chromosome 13 |
Location: | 3372451 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g586800 | (1 of 8) IPR001810//IPR006553 - F-box domain // Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGCTGTCCAAGCTGGATAACCTGGGCG |
Internal bar code: | CCTCTCCTCAAGAAAATTTTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 973 |
LEAP-Seq percent confirming: | 99.3308 |
LEAP-Seq n confirming: | 1039 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTCGCTAAACTCGTCTGC |
Suggested primer 2: | GTGTGTTGCGCTGTGATTCT |