Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.209464 |
Chromosome: | chromosome 17 |
Location: | 5912902 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g740050 | (1 of 2) IPR003582//IPR011050//IPR019316 - ShKT domain // Pectin lyase fold/virulence factor // G8 domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCAAGTAGCAGGTAGGAGTCACGCACGG |
Internal bar code: | GAATTCAGGCGGGCGCGACTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 495 |
LEAP-Seq percent confirming: | 98.0952 |
LEAP-Seq n confirming: | 2266 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTATGGGTATGTGCAGCGTG |
Suggested primer 2: | GGGAACAGTAGTGATGCGGT |