| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.209501 |
| Chromosome: | chromosome 2 |
| Location: | 6679919 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117813 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCCCCTTCCCCTCCCGCGCGGAAGCGC |
| Internal bar code: | CGTGTCGGGTTTTATCCGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 188 |
| LEAP-Seq percent confirming: | 98.5685 |
| LEAP-Seq n confirming: | 964 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGACTGGGATCGACAACT |
| Suggested primer 2: | AGACAACATCCGTAATCGCC |