| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.209699 |
| Chromosome: | chromosome 17 |
| Location: | 920287 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702850 | CAV5 | (1 of 5) PTHR10037//PTHR10037:SF218 - VOLTAGE-GATED CATION CHANNEL CALCIUM AND SODIUM // SUBFAMILY NOT NAMED; Voltage-gated Ca2+ channel, alpha subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTGCGGCAGTCGGTGTCACCGCCGCAA |
| Internal bar code: | TGTTTGGTCCCTGGGTCACTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 248 |
| LEAP-Seq percent confirming: | 99.2225 |
| LEAP-Seq n confirming: | 1021 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACTGCTGCTACTGCAAA |
| Suggested primer 2: | ACCTCCACCACTCCCACTC |