Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.209704 |
Chromosome: | chromosome 16 |
Location: | 2375118 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g659950 | PRPS5 | Chloroplast Ribosomal Protein S5; (1 of 2) K02988 - small subunit ribosomal protein S5 (RP-S5, MRPS5, rpsE) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGATGGGCCTGTGTGGCCGGTTCTTGTG |
Internal bar code: | CTTGGGACGAGGTATGTGTTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 351 |
LEAP-Seq percent confirming: | 99.7596 |
LEAP-Seq n confirming: | 3735 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCGCAAGACTGATTGACT |
Suggested primer 2: | CAGCCGGTCATAAACCTTGT |