| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209752 |
| Chromosome: | chromosome 12 |
| Location: | 1838541 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g511850 | GSK3 | (1 of 1) K03083 - glycogen synthase kinase 3 beta (GSK3B); Glycogen Synthase Kinase 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGAACATAACGCCCAAACCCCTGGCTT |
| Internal bar code: | TGTCGCACGCGTGGCACCCCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 940 |
| LEAP-Seq percent confirming: | 98.7609 |
| LEAP-Seq n confirming: | 5978 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGAAAGAACGCAACAC |
| Suggested primer 2: | TCTGGGAGTAGCGCGTAGTT |