Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.209771 |
Chromosome: | chromosome 14 |
Location: | 3386644 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g630301 | (1 of 1) IPR000104//IPR001890//IPR029058 - Antifreeze protein, type I // RNA-binding, CRM domain // Alpha/Beta hydrolase fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATACCCTGCGGTACACGCCCTGGGGCAT |
Internal bar code: | GTTAATCGGGTGGGACTTCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 335 |
LEAP-Seq percent confirming: | 98.7013 |
LEAP-Seq n confirming: | 304 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGCGTTTTGTTAAGGCAT |
Suggested primer 2: | TGTCTGAGGTTGTGAGTCGC |