Insertion junction: LMJ.RY0402.209784_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.209784
Chromosome:chromosome_10
Location:1637065
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCATCGCAAACTCCACCCGGCCCGCTACAA
Internal bar code:CACTCTCACCCCCGATCGTGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:858
LEAP-Seq percent confirming:95.5177
LEAP-Seq n confirming:15471
LEAP-Seq n nonconfirming:726
LEAP-Seq n unique pos:68

Suggested primers for confirmation by PCR

Suggested primer 1:CGTTGGAACATTGGAGGAGT
Suggested primer 2:CGGCAGTCATCTTCTTCACA