| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209824 |
| Chromosome: | chromosome 6 |
| Location: | 1999587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g264150 | MAW11 | Membrane-associated hydroxyproline-rich glycoprotein 11; (1 of 1) 2.1.1.53 - Putrescine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATATGATTGCACATGCAACCCAAGCTC |
| Internal bar code: | CCAGGAGGTAGGGCGTGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1025 |
| LEAP-Seq percent confirming: | 98.8627 |
| LEAP-Seq n confirming: | 2434 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATACTATGCTCGCCTGCAA |
| Suggested primer 2: | TGAGAATGTTGCTGAGTGGC |