| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209925 |
| Chromosome: | chromosome 1 |
| Location: | 53400 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000250 | SNR1 | (1 of 2) PTHR12677:SF5 - TVP38/TMEM64 FAMILY MEMBRANE PROTEIN YDJX; Predicted SNARE-associated Golgi protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAAACAGCCGGCACCCACCGTACAGGGC |
| Internal bar code: | AAAAGAACAGCGGAGAGGATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 882 |
| LEAP-Seq percent confirming: | 96.3225 |
| LEAP-Seq n confirming: | 2724 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGGTAGACGTAGGCAAA |
| Suggested primer 2: | CTATTCGTTCTTTCCGCTGC |