| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.209938 |
| Chromosome: | chromosome 12 |
| Location: | 7328396 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557350 | FAO9 | (1 of 1) PF00355//PF01266 - Rieske [2Fe-2S] domain (Rieske) // FAD dependent oxidoreductase (DAO); FAD-dependent oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGATAATTTCCGGGTTGAGGGGTGGTGGA |
| Internal bar code: | TGGCCGCACACAGCGGCGGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 92.5673 |
| LEAP-Seq n confirming: | 22766 |
| LEAP-Seq n nonconfirming: | 1828 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCACTAATGCACAGGTTG |
| Suggested primer 2: | AGAGAGGAGTTCGGGGATGT |