| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.209995 |
| Chromosome: | chromosome 12 |
| Location: | 753493 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g495350 | POC12 | (1 of 1) K19332 - Meckel syndrome type 1 protein (MKS1); Proteome of centriole protein 12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTGCGCAAAACCCGAACATTACGGCGC |
| Internal bar code: | GAGGGTATGATCAGCTTGTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 98.6859 |
| LEAP-Seq n confirming: | 751 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTCTGGGTTGAGCCAGTT |
| Suggested primer 2: | CTAGTGAACCCGGAAGGGAT |