| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210056 |
| Chromosome: | chromosome 9 |
| Location: | 7813953 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416500 | CGL151 | Conserved in the Green Lineage; (1 of 2) IPR026939 - At2g23090-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTTCCCCTTGCATAGGACAAGTGTTCCC |
| Internal bar code: | GAACTACACACGGGCGCAAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 803 |
| LEAP-Seq percent confirming: | 99.5975 |
| LEAP-Seq n confirming: | 2227 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTATCAGGCTCAGGAGG |
| Suggested primer 2: | CTCTGCGGGTTTAGATGAGC |