| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210082 |
| Chromosome: | chromosome 12 |
| Location: | 3284852 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498050 | CPS3 | Putative subunit of mRNA cleavage and polyadenylation specificity factor; (1 of 1) K14403 - cleavage and polyadenylation specificity factor subunit 3 (CPSF3, YSH1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCCAGCCCCCGCCCCCAAACCACGCCC |
| Internal bar code: | CCCGAAAAAGTGAATGACGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 41.4918 |
| LEAP-Seq n confirming: | 178 |
| LEAP-Seq n nonconfirming: | 251 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCGCTACATCCTCAACAC |
| Suggested primer 2: | CCTCTCACGATGCCTAGCTC |