| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.210087 |
| Chromosome: | chromosome 8 |
| Location: | 1641856 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g365600 | THI1 | Thiamine biosynthetic enzyme; (1 of 1) 2.7.4.7 - Phosphomethylpyrimidine kinase / Hydroxymethylpyrimidine phosphokinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTGTGGGCAGCGGTGGACAGGGAGGGA |
| Internal bar code: | GCCGTGGCGAGAGTGTCACAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1021 |
| LEAP-Seq percent confirming: | 98.2022 |
| LEAP-Seq n confirming: | 3769 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCAGAAGCGCTAGAGGA |
| Suggested primer 2: | TGACTTTGTCAAGCTCCACG |