Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.210178 |
Chromosome: | chromosome 10 |
Location: | 1834587 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g431150 | FAP256,ROC22,CEP104 | Flagellar Associated Protein 256; (1 of 1) PTHR13371:SF0 - CENTROSOMAL PROTEIN OF 104 KDA | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCAGCACGCCGTACTGCACCCCCCAA |
Internal bar code: | TATTGGGAGAAGAATTGAAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 487 |
LEAP-Seq percent confirming: | 99.7705 |
LEAP-Seq n confirming: | 3478 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAACAGGGTAGAGCGGGTT |
Suggested primer 2: | TTGATACTCATGCCAGCGAG |