| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.210362 |
| Chromosome: | chromosome 17 |
| Location: | 4410086 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g731700 | FMO2 | Flavin-containing monooxygenase; (1 of 1) PF00743//PF13450 - Flavin-binding monooxygenase-like (FMO-like) // NAD(P)-binding Rossmann-like domain (NAD_binding_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGAACAGCCCGGGCACCCGCGGGCTCAT |
| Internal bar code: | CGGGATATGCGTGGCGCGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 99.1597 |
| LEAP-Seq n confirming: | 236 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAATCTTGGGACAACAGCC |
| Suggested primer 2: | CCGTGTCCTGTTGTATGTGC |