| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.210429 |
| Chromosome: | chromosome 12 |
| Location: | 2129746 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508900 | MAPK6 | (1 of 3) K04371 - mitogen-activated protein kinase 1/3 (MAPK1_3); Mitogen-Activated Protein Kinase 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACTGCAGACGCACACTCAACACAAGTG |
| Internal bar code: | TAAGACTCTATAACCTAGTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 326 |
| LEAP-Seq percent confirming: | 99.2248 |
| LEAP-Seq n confirming: | 1024 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCTTTCAGTGCAGTGCCG |
| Suggested primer 2: | CGGAGTGATAGTGCTCGTCA |