| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210543 |
| Chromosome: | chromosome 5 |
| Location: | 3331004 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240533 | (1 of 2) IPR002867//IPR013083//IPR031127 - IBR domain // Zinc finger, RING/FYVE/PHD-type // E3 ubiquitin ligase RBR family | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATTCATCCATACGGGAATTTGCGGAACC |
| Internal bar code: | CGGCTCGAGGGGTGACAGTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 975 |
| LEAP-Seq percent confirming: | 99.9628 |
| LEAP-Seq n confirming: | 8066 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGAGCGTGGTGATGGAG |
| Suggested primer 2: | GACACCTTGTCCGCAATTTT |