| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.210547 |
| Chromosome: | chromosome 12 |
| Location: | 7140754 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559053 | CSB50 | {"Probable transposon-derived protein of Chlamydomonas-Specific family B; (1 of 20) IPR010095//IPR013083 - Transposase IS605, OrfB, C-terminal // Zinc finger, RING/FYVE/PHD-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGACTAGGACAGAGCATCGTGCGGTGTA |
| Internal bar code: | CGTTGGATCTTCGTGCGTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 99.5442 |
| LEAP-Seq n confirming: | 4368 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGTGTGTGTGATGGGACA |
| Suggested primer 2: | TGTACAGTAGGAGGCCCTGG |