| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.210558 |
| Chromosome: | chromosome 1 |
| Location: | 2617232 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015200 | PDE4 | (1 of 17) 3.1.4.53 - 3',5'-cyclic-AMP phosphodiesterase / cAMP-specific phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACCCTGCACGCCGGAAGCCGCCGGCCA |
| Internal bar code: | TAAAATTGGGACGACTCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 519 |
| LEAP-Seq percent confirming: | 99.2391 |
| LEAP-Seq n confirming: | 913 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACATGGACGTGAGTATGG |
| Suggested primer 2: | CTCATCTGTAAGCTGCGACG |