Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.210601 |
Chromosome: | chromosome 7 |
Location: | 453760 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g315450 | CSG2 | Predicted protein of CSG family | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGGGCTGCCGACCAGCGTCCACCCGC |
Internal bar code: | TAATAACTACCCGTGACCGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 817 |
LEAP-Seq percent confirming: | 98.9261 |
LEAP-Seq n confirming: | 18424 |
LEAP-Seq n nonconfirming: | 200 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTAAACTCTCGGCTTCGG |
Suggested primer 2: | TCCTCCTCCTCTAGCTGCTG |