| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.210612 |
| Chromosome: | chromosome 9 |
| Location: | 2658591 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390000 | SRH17 | SNF2-related DNA/RNA helicase; (1 of 2) K11654 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 [EC:3.6.4.-] (SMARCA5, SNF2H, ISWI) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAATGTGCTCTTGCTTACACAGCGTCAGT |
| Internal bar code: | GGGGGAGGCCAATCATGCAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 233 |
| LEAP-Seq percent confirming: | 88.1841 |
| LEAP-Seq n confirming: | 1724 |
| LEAP-Seq n nonconfirming: | 231 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAAAAGGGTCTTACCGA |
| Suggested primer 2: | CCGGTGTTGAAGTTTGGAGT |