| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.210678 |
| Chromosome: | chromosome 16 |
| Location: | 5743523 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678700 | (1 of 133) IPR012336 - Thioredoxin-like fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGGCCTCGTGCTTCTGCCACGAGTCCT |
| Internal bar code: | GCACAGTATCGCCCCCACCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 300 |
| LEAP-Seq percent confirming: | 63.5659 |
| LEAP-Seq n confirming: | 246 |
| LEAP-Seq n nonconfirming: | 141 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCCATCAATACCTGCATC |
| Suggested primer 2: | GAGCCAGTAAATGGTCGCAT |