| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.210694 |
| Chromosome: | chromosome 14 |
| Location: | 3603299 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631150 | CEP14 | (1 of 1) 2.4.2.26//2.7.11.1 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; Cysteine endopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCTCCCCGCGCACCTGGGTTGTAGGCT |
| Internal bar code: | TCTCCCACCTTTGGGTGACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1012 |
| LEAP-Seq percent confirming: | 99.5126 |
| LEAP-Seq n confirming: | 10412 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCATACGATGATGATGGAG |
| Suggested primer 2: | CCTCAAGCTTTCTGACCCTG |