| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210728 |
| Chromosome: | chromosome 5 |
| Location: | 1840006 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241950 | VDAC2,ASC2 | (1 of 2) K15040 - voltage-dependent anion channel protein 2 (VDAC2); Voltage-dependent anion-selective channel protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAAGCACAAATGCACCAGCCGTACGGT |
| Internal bar code: | AGTTGTGACCGGCATTTGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 973 |
| LEAP-Seq percent confirming: | 99.3335 |
| LEAP-Seq n confirming: | 14456 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTCTGTACGAGACCAAGC |
| Suggested primer 2: | CGTCCACGAGCTACTTCCTC |