| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.210798 |
| Chromosome: | chromosome 9 |
| Location: | 2080009 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393950 | FHL2,FTSHI3,FTSHi3,FHL8 | (1 of 6) K03798 - cell division protease FtsH [EC:3.4.24.-] (ftsH, hflB); Putative chloroplast-import FtsH-like ATPase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCGCGGCTGGCCTGCTTCAGAAAATGC |
| Internal bar code: | AAGTGCCTTCCGTAGAATCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 697 |
| LEAP-Seq percent confirming: | 99.5905 |
| LEAP-Seq n confirming: | 5837 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCAGGAGAAGCAACAGCA |
| Suggested primer 2: | AGATTGCAGTATTGGGCCAG |