| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210820 |
| Chromosome: | chromosome 9 |
| Location: | 3154390 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387060 | (1 of 1) K08202 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 4/5 (SLC22A4_5, OCTN) | CDS/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAAGGAGGGGCACTTGCACGCGGTCCAT |
| Internal bar code: | CGGCCTCCGACTGAGGGGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 415 |
| LEAP-Seq percent confirming: | 98.9311 |
| LEAP-Seq n confirming: | 3702 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCCATCTTCACCACCCAG |
| Suggested primer 2: | CCACACACAGCGTAATGGTC |