Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.210876 |
Chromosome: | chromosome 17 |
Location: | 3344565 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g723450 | FAP13 | WD-repeat Flagellar Associated Protein 13; (1 of 1) IPR001680//IPR007111//IPR017986//IPR020472//IPR027417 - WD40 repeat // NACHT nucleoside triphosphatase // WD40-repeat-containing domain // G-protein beta WD-40 repeat // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCCACCTTCCCATGCACACCACATGCA |
Internal bar code: | GAGTGGTAAAAGTGAGGACGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 724 |
LEAP-Seq percent confirming: | 99.8893 |
LEAP-Seq n confirming: | 902 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGCTCACTGCCTGTTGTC |
Suggested primer 2: | CTATTGTGCAACATGGGTCG |