| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210941 |
| Chromosome: | chromosome 3 |
| Location: | 6721205 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197700 | HLM8 | (1 of 1) PTHR13793//PTHR13793:SF100 - PHD FINGER PROTEINS // HISTONE-LYSINE N-METHYLTRANSFERASE ATX1-RELATED; Histone-lysine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGGAGAGGATCGTGGCAGCTAGTGGTAG |
| Internal bar code: | CGCCCGGGGGCCTTAATGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 98.8677 |
| LEAP-Seq n confirming: | 3056 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTGACATCCACCGCTAT |
| Suggested primer 2: | CACCTTGACCTGGAACTGGT |