Insertion junction: LMJ.RY0402.211001_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.211001
Chromosome:chromosome_3
Location:8326663
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g199000 PHT1,PHOT,PHOT1 Phototropin antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTGCGTGGGTGCTAGTGCAGGCGTGGGGA
Internal bar code:TGAATCGAAATGCGGAACGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:773
LEAP-Seq percent confirming:99.452
LEAP-Seq n confirming:23409
LEAP-Seq n nonconfirming:129
LEAP-Seq n unique pos:95

Suggested primers for confirmation by PCR

Suggested primer 1:AGCATCAGTCTGCAATCCCT
Suggested primer 2:GGTGTGCAGTCCTGAGACAA