| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211005 |
| Chromosome: | chromosome 4 |
| Location: | 378253 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217914 | WDR65,FAP57,BOP2 | (1 of 1) IPR001680//IPR011047//IPR015943//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain; Flagellar Associated Protein 57 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACGAGCAAAAGTGAGTGCCGCGACGACC |
| Internal bar code: | ATAGCACCGCTTTGGTATAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 242 |
| LEAP-Seq percent confirming: | 99.3135 |
| LEAP-Seq n confirming: | 434 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATGTTGTATGACAAGCCG |
| Suggested primer 2: | CCTATTGCTCGAAGCTCCAC |