| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.211081 |
| Chromosome: | chromosome 11 |
| Location: | 3228184 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479600 | MHX1,CAX6 | (1 of 1) K05849 - solute carrier family 8 (sodium/calcium exchanger) (SLC8A, NCX); putative Ca2+/Na+ exchanger | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGTTAGTGCCGCTGCCCTAGCCCCCTC |
| Internal bar code: | GCTCGTGGAGCGGCCGCAACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 277 |
| LEAP-Seq percent confirming: | 94.2308 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAAGTCCGCTCATGGAGA |
| Suggested primer 2: | CATACGGTACATGCACTGCC |