| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211103 |
| Chromosome: | chromosome 6 |
| Location: | 2435951 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268550 | GTR,CGL121,CSL1 | Cellulose-synthase-like 1; (1 of 1) 2.4.1.32 - Glucomannan 4-beta-mannosyltransferase / Glucomannan-synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTCCTCCTCCTCCCGCTCCTCCTCAAT |
| Internal bar code: | CTGTAAGAGAATAACGGATGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGCTTACTTCATCACCA |
| Suggested primer 2: | GTACGATTGTTCATGCCACG |