| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211192 |
| Chromosome: | chromosome 12 |
| Location: | 2060367 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509750 | QCR2,MPPA2 | (1 of 2) 1.10.2.2//3.4.24.64 - Quinol--cytochrome-c reductase / Ubiquinone--cytochrome-c oxidoreductase // Mitochondrial processing peptidase / Processing enhancing peptidase; Ubiquinol:cytochrome c oxidoreductase core II subunit of mitochondrial Complex III | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCAACCCCTGCTGTGGCGATACCCACTG |
| Internal bar code: | GCAGGGTGGACAGGCTTCCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1063 |
| LEAP-Seq percent confirming: | 97.4353 |
| LEAP-Seq n confirming: | 12765 |
| LEAP-Seq n nonconfirming: | 336 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTGACCAGCTACGTGAA |
| Suggested primer 2: | GAGAGACTTGTGGAAAGGCG |