| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.211199 |
| Chromosome: | chromosome 9 |
| Location: | 2145776 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393400 | VTE4 | Tocopherol O-methyltransferase/gamma-tocopherol methyltransferase; (1 of 1) 2.1.1.95 - Tocopherol O-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTTGTCAGGTCAACGCTACTTGATTCT |
| Internal bar code: | CTAACCGGCGCGATTCAGGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 759 |
| LEAP-Seq percent confirming: | 99.7435 |
| LEAP-Seq n confirming: | 3111 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGGGCAACACGACTAGG |
| Suggested primer 2: | GCAGCAGTAGTAGCAGTGCG |