| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211200 |
| Chromosome: | chromosome 10 |
| Location: | 3840487 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447350 | SEC23B | (1 of 1) PF04810//PF04811 - Sec23/Sec24 zinc finger (zf-Sec23_Sec24) // Sec23/Sec24 trunk domain (Sec23_trunk); COP-II coat subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGGAGGGGTTGTACATACCAGCCCAAA |
| Internal bar code: | GTGTCTCGCAATGCGACCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 271 |
| LEAP-Seq percent confirming: | 99.6916 |
| LEAP-Seq n confirming: | 6464 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCACAGACATCCCCGTT |
| Suggested primer 2: | AGCAAGAAAAGCAGAGGCTG |