| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211214 |
| Chromosome: | chromosome 13 |
| Location: | 2903050 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583600 | DGD1 | Digalactosyldiacylglycerol synthase; (1 of 1) 2.4.1.241 - Digalactosyldiacylglycerol synthase / UDP-galactose:MGDG galactosyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTAGATAGTTTTCAGTCGACGGTCATTC |
| Internal bar code: | CAGCGGAGCCTACTGCTTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 911 |
| LEAP-Seq percent confirming: | 99.2462 |
| LEAP-Seq n confirming: | 395 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCCTCAACCACCTGATCC |
| Suggested primer 2: | GTTTTTCGCGACCAAGTCAT |