| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211230 |
| Chromosome: | chromosome 3 |
| Location: | 575489 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145487 | (1 of 5) IPR001841//IPR013083 - Zinc finger, RING-type // Zinc finger, RING/FYVE/PHD-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAGTCTAATCTAGCCACCTAACCCAGC |
| Internal bar code: | GTCGTGCCCTGTCGGCTGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 555 |
| LEAP-Seq percent confirming: | 96.9874 |
| LEAP-Seq n confirming: | 9272 |
| LEAP-Seq n nonconfirming: | 288 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAGGACCAGCACCTCAT |
| Suggested primer 2: | CTTCTGGGCTTCCATCTGAG |