Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.211420 |
Chromosome: | chromosome 6 |
Location: | 3165048 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275500 | (1 of 4) IPR000104//IPR001471//IPR016177 - Antifreeze protein, type I // AP2/ERF domain // DNA-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACATCAAGCGCTCACTGTAACTACGCA |
Internal bar code: | CGGGGGTCACAGCCGGTCAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 724 |
LEAP-Seq percent confirming: | 99.2734 |
LEAP-Seq n confirming: | 1093 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTAACATCGGACACTGCT |
Suggested primer 2: | TGCTGCTTTATCCATTGCAG |