| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211423 |
| Chromosome: | chromosome 10 |
| Location: | 1865256 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g431450 | NAT24 | N-acetyltransferase; (1 of 1) 2.3.1.1//2.3.1.88 - Amino-acid N-acetyltransferase / N-acetylglutamate synthase // Peptide alpha-N-acetyltransferase / Protein N-terminal acetyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATTGCCGGCAAAATGCGGGCGCCCACG |
| Internal bar code: | ACGAGTGTCAGACTATCAATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 76 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGAGCACATACCGTAGA |
| Suggested primer 2: | TGTAAGCTTGTCAGCGATGG |