Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.211453 |
Chromosome: | chromosome 7 |
Location: | 5933723 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g354250 | PGK2 | (1 of 2) PF00162 - Phosphoglycerate kinase (PGK); Phosphoglycerate kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTCGAACAGGCGGTGCGCCAGCTCTGTG |
Internal bar code: | AAAGGCCAACGGAAGTCGCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 272 |
LEAP-Seq percent confirming: | 99.7131 |
LEAP-Seq n confirming: | 17032 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTTGTTTGTGGGTCTGGC |
Suggested primer 2: | ATCACAGATGTGGACGTGGA |